Skip to content

Creationist crankery flashback: Richard Dawkins stumped?

July 12, 2007

Recently, I saw a clip on YouTube that uncharacteristically, twinged a feeling of de ja vu but not an actual recollection (uncharacteristic for me; I can usually recall something if I have a memory of it). It was an interview with Richard Dawkins.

Suffice to say, I couldn’t recall the background so I was left to form opinions based on what knowledge I had at hand at the time. I was going to blog about it and point out some mistakes in the implicit message as well as in the triumphalism of the creationist response.

I’ve recently come across accounts of what happened (the missing background information) so the penny has really dropped (add to that there now seems to be a mass YouTube response pointing out the fraud). However, I’ll post the video, then my previous thoughts, before dumping the background story on you.

Response to creationist question

Okay, in answer to the initial creationist question; Flavobacterium Sp. 172 frame-shift mutation allowing the breakdown of nylon. This is the example I’d give to creationists (and have given in the past to the usual response of fingers-in-ears and fallacy) these days, although Dawkins would have had to have used a different mutation as an example given the date of the interview preceding the observation of the mutation of Flavobacterium Sp. 172.

For those who don’t have an understanding of basic genetics (and you’ll need this to get your head around the significance of a frame shift mutation), a strand of nucleic acid is made up of a sequence of four different types of nucleotides. Groups three nucleotides long along the strands of nucleic acid code for a range of amino acids, based on the combination of the four types of nucleotides (4 x 4 x 4 giving a total of 64 possible combinations for each group of three).

A bit abstract so far I know. Please bear with me.

Now, when a group of three nucleotides codes for the amino acid methionine, this is a start codon. It signals the start of a sequence of amino acids.

There are a number of combinations of three nucleotides that form a stop codon and when such combinations are reached during translation it signals the end of a sequence of amino acids. Including the amino acid corresponding to the start codon (methionine), these sequences of amino acids are linked together (by way of a condensation reaction in the ribosome) to form peptides, or in layman’s terms; proteins.

Insulin, histamine, dopamine, adrenalin, growth hormone, IGF-1, blood clotting factors, digestive enzymes and a whole host of other peptides your body needs to function properly are formed at least initially by this process. The sequence of amino acids to make these important hormones/enzymes are translated from your genes.

You can probably work out now what may happen to these enzymes and hormones in people who inherit mutations to the nucleotide sequences coding for them. Tay-Sachs disease is an example, with a range of possible inherited mutations to chromosome 15 damaging the sequence (aka gene) for beta-N-acetylhexosaminidase A; an enzyme that prevents build-ups of gangliosides in the neurons of the brain.

In any case, put a simply as I can, a frame-shift mutation (such as in the example I and others have used to rebut the creationist question) is one where the sequence of nucleotides is altered by the insertion or deletion of a number of nucleotides not divisible by three. This doesn’t just add or take away genetic information, it alters the way existing genetic material is interpreted.

Take for example a hypothetical strand of RNA (AUGGUCAUACUGCAGUAGUAUAUAAAA*) and the amino acid sequence it codes for;

AUG Methionine (START CODON)
GUC Valine
AUA Isoleucine
CUG Leucine
CAG Glutamine
UAG STOP CODON
UAU Tyrosine**
AUA Isoleucine**
AAA Lysine**

* A, U, G and C represent the 4 types of nucleotide (base pairs) in RNA.

** Nucleotides following a “STOP” without a “AUG” for methionine to start things off again, as can be expected, are not translated.

Translated from top-to bottom, this would give us a peptide 5 amino acids long in the sequence of methionine, valine, isoleucine, leucine and finally glutamine. But look what happens if we add just two nucleotides (“AA”) early in the sequence.

AUG Methionine
AAG Lysine
UCA Serine
UAC Tyrosine
UGC Cysteine
AGU Serine
AGU Serine
AUA Isoleucine
UAA STOP
AA (codes for nothing)

With the addition of just two nucleotides, we now have an 8 amino acid long polypeptide with the sequence of methionine, lysine, serine, tyrosine, cysteine, serine, serine, isoleucine. There was no serine in the original sequence, now the peptide is serine rich.

There was no cysteine in the original, and the addition of a cysteine is significant because cysteine can form di-sulphide bonds; if there was a second cysteine elsewhere in the sequence the two cysteines could have bound together folding the peptide into a loop.

In short, a frame-shift mutation can radically alter a peptide/protein, altering the amino acids in the sequence and if displacing stop codons, possibly resulting in a much larger and complex peptide. This is what happened in Flavobacterium Sp. 172; the resultant peptide being “nylonase”, an enzyme that can break down nylon.

Now if we want to talk “information” with the creationists, have a look at the amount of information coding for the two different peptides. Pre and post mutation it’s a ratio of 5:8. And no, the “lost” tyrosine, isoleucine and lysine at the end of the original sequence don’t count as “information”; they weren’t translated in the first place.

Not all mutations are deleterious like those causing Tay-Sachs and some mutations can lead to an “increase in information”. It’s called evolution folks.

Richard Dawkins’ Response

Richard Dawkins talks about intermediates, and the common fallacy that we are descended from modern animals. From what I gathered when I first watched the clip, I gathered Richard Dawkins was trying to ascertain the premise behind the question he was asked.

Indeed, his question does address the modus operandi of the creationists who ask these kinds of “God of the gaps” questions. The creationist finds an area where a scientific theory has not been fully researched, points to the gap in knowledge and claims victory by default (the victory being short lived once the gap is filled in with the results of research; see where “irreducible complexity” meets the sea sponge.)

If the intermediates that Dawkins talks about were alive today alongside their modern counterparts, we could easily undertake genetic research into their differences and the “increases in information”. However, the reality that they aren’t around makes research in evolutionary biology difficult and inevitably means that there will be gaps in our knowledge of the genetic history of life on Earth.

Indeed, if we are to turn the creationists’ absurdity back on themselves so that we could “win by default” and take advantage of practical obstacles to research, we could ask all sorts of silly questions. “Creationist, are you aware of any genetic testing directly confirming the paternal status of Adam to any modern member of the human race?”

The “no example of an increase in information” meme is just another in the series of “God of the gaps” canards doing the rounds by means of the uncritical parroting of a faithful but unthinking and opportunistic movement. Dawkins’ response, while awkward, is actually on topic, although you may be forgiven for thinking otherwise.

The missing details

And this is Dawkins’ account of what happened behind the scenes.

In September 1997, I allowed an Australian film crew [from the then Answers in Genesis] into my house in Oxford without realising that their purpose was creationist propaganda. In the course of a suspiciously amateurish interview, they issued a truculent challenge to me to “give an example of a genetic mutation or an evolutionary process which can be seen to increase the information in the genome.” It is the kind of question only a creationist would ask in that way, and it was at this point I tumbled to the fact that I had been duped into granting an interview to creationists – a thing I normally don’t do, for good reasons. In my anger I refused to discuss the question further, and told them to stop the camera. However, I eventually withdrew my peremptory termination of the interview as a whole. This was solely because they pleaded with me that they had come all the way from Australia specifically in order to interview me. Even if this was a considerable exaggeration, it seemed, on reflection, ungenerous to tear up the legal release form and throw them out. I therefore relented.

My generosity was rewarded in a fashion that anyone familiar with fundamentalist tactics might have predicted. When I eventually saw the film a year later 1, I found that it had been edited to give the false impression that I was incapable of answering the question about information content 2. In fairness, this may not have been quite as intentionally deceitful as it sounds. You have to understand that these people really believe that their question cannot be answered! Pathetic as it sounds, their entire journey from Australia seems to have been a quest to film an evolutionist failing to answer it.”

(Richard Dawkins, 1998)

Grrrr…. Barry Williams wrote about the alleged scam in a 1998 edition of The Skeptic. His analysis can be found here.

Well I’m off to bed now. Nite, nite.

~ Bruce

61 Comments
  1. July 12, 2007 9:24 am

    Definitely not the only time the creationists have resorted to lies and deception: remember that Way of the Master episode, “The Evolution Zone,” where Ray Comfort and Kirk Cameron, in addition to completely misrepresenting evolution, proceed to “prove it wrong” by asking laypeople in the street asinine questions like: “So . . . here is this animal that comes out of the water without lungs, and so he comes out with gills and then goes Puff! Puff! Puff! and then runs back in the water and then keeps coming out until lungs develop? Wow! . . . Was he male or female?” The dishonesty is justified, in their view, because they haven’t the slightest interest in doing science for its own sake: science–or rather, the veneer of science, scienciness–is just another vehicle for proselytising and evangelising. You know all this already, but it certainly bears repeating.

  2. August 20, 2007 3:23 am

    I believe this interview was part of an Answers in Genesis video called “from a frog to a prince” a kids video which shows that they are perfectly fine lying to children.

  3. August 20, 2007 9:55 am

    Yep. I knew that… Although I don’t know why I didn’t mention it. Thanks for that Globalflood.

  4. Melanie Stephan permalink
    September 8, 2007 11:13 pm

    Hi, Bruce. I enjoyed reading what you wrote about basic genetics. You should read Richards lastest book titled, “I am so much smarter than God”. At the very beginning of the book he states God never finished High School and that he holds a number of BS degrees from various Universities. In the next chapter he then explains
    in scientific terms everything in the Universe and how it works. He then continues to name each and every species and how they are a benefit to the ecosystem. In Chapter 3 there are pictures of Richard in the Lab actually creating new life. Turning the page I see a picture of Dawkins and Darwin receiving an award for their work in science. Funny how the name Dawkins and Darwin are almost the same. Then in the last chapter, he goes on to say “See even I can create life, it’s not that hard”.
    All I have to say is: Richard do you really expect us to believe that you can create life out of nothing? Don’t you think that people are going to say your nuts? If your going to state that your a scientist I’d think you should have some proof to back up your statements?

  5. September 9, 2007 12:24 am

    Richard do you really expect us to believe that you can create life out of nothing?

    He never claimed he could.

    Melanie, I’m curious. Why do religious Dawkins haters engage in such dishonesty when apparently it’s prohibited by their religion?

  6. Melanie Stephan permalink
    October 20, 2007 3:22 am

    Hi Bruce, I don’t hate Dawkins. I was just a little mad at him at the time. I am not religious either. You’ll never find me in Church on Sunday. God just gave me a job to do. Now, I couldn’t say ‘NO’. Someday I might want God to do something for me so I have been posting for him. God wanted me to post the meaning of First is Last and Last is First to everyone. And I have been posting it everywhere. While I was posting I was reading other peoples posts to. Some one said something about Richard Dawkins. So I Googled his name. He is an Atheist! Not only is he an Atheist, he wrote a book about it. I am thinking, Oh my God, I would never do something like that. Yea, I was mad. Here I am working for free and Richard is out making a buck saying God is like a fairy tale. It was all counter productive. I am putting rocks in the dam and he is taking them out. I am putting up signs for God and he is tearing them down. So I decided to make fun of him, just like a presidential campaign. Let’s get dirty. Anyway there is a problem with fighting with pigs. You only get dirty and the pig enjoys it.

    Then God has a talk with me. God says that Richard is not going to hell for being an Atheist. God says that he is an embrassment yet he is fond of him. He thinks of him as a pet. He holds affection for him. Judgment day could be hard on him though. Richard does go to Heaven.
    Now I am sorry for what I said about Richard. Richard is entitled to his wrong opinion. We all have the right to be wrong now and again without being sent to Hell for it. I am no longer mad at Richard as long as he doesn’t say anything about Jesus. Richard leave Jesus alone. I love Jesus.

    Again Bruce, Thank you for allowing me to write on your site. Sorry it took me so long to get back to you. Melanie Stephan

  7. October 20, 2007 8:28 am

    What the …?

  8. Melanie Stephan permalink
    October 20, 2007 7:52 pm

    That’s right Bruce. I am not a ……& church lady. To get you up to speed here is Gods message. Gods big issue is about the meaning of First is Last and Last is First . The message is this:
    In the morning I go to Heaven. In the afternoon I live my life. In the evening I die, death. What does this mean? In other words this means Birth is Last and Last is Birth. To understand this don’t think from point A to point B. Think of this as a continuous circle of life. Birth, Life, Death, Birth. God also said that Judgment will be before Birth in Heaven. AS birth on Earth is painful so will birth in Heaven. It is possible that this message was delivered by one of God’s Angels. Yes, God has recently made contact and he sent a messenger. Spread this message along, just like a chain letter. OH, one more thing of interest. Did you know that Mike Douglas Died on his Birthday? Melanie

  9. Melanie Stephan permalink
    October 20, 2007 7:57 pm

    Another thing God also talked about the first 8 steps in Cell growth. I think he talked about that just to let people know he knows something about biology. How many fields of science do you think he knows about? All of them.

  10. October 20, 2007 10:02 pm

    Melanie: get thee to a shrink.

  11. Melanie Stefine permalink
    October 20, 2007 11:50 pm

    AV: I am the perfect size. Maybe a shrink could fix your head. Me thinks it’s to big.

  12. October 21, 2007 8:46 am

    Touche.

    But the case remains that you are not the first or only person in the world claiming to have received messages from God, and you won’t be the last.

    Sadly, it never dawns on any of you that personal testimony does not constitute good evidence for God’s existence, let alone the claim that God has spoken to you (which implies the claim that a God exists). Not even close. If I were to tell you that a spaceship full of green aliens landed in my backyard last night, would you take my word for it? Think about it.

    Now, I don’t think you’re lying about what you claim to have experienced. I accept that you believe that God spoke to you–but this does not mean that it actually happened. There are natural explanations (e.g. auditory hallucination), and parsimony demands that you rule out natural explanations absolutely before you posit supernatural ones.

    Here’s some chain mail for you:
    Critical Thinking on the Web
    “A Mini Guide to Critical Thinking” (PDF)
    “The Belief Engine” (James Alcock)

    Salvation lies within.

  13. October 21, 2007 8:54 am

    That’s right Bruce. I am not a ……& church lady. To get you up to speed here is Gods message. Gods big issue is about the meaning of First is Last and Last is First . The message is this:
    In the morning I go to Heaven. In the afternoon I live my life. In the evening I die, death.

    “The most unfair thing about life is the way it ends. I mean, life is tough. It takes up a lot of your time. What do you get at the end of it? A Death! What’s that, a bonus? I think the life cycle is all backwards. You should die first, get it out of the way. Then you live in an old age home. You get kicked out when you’re too young, you get a gold watch, you go to work. You work forty years until you’re young enough to enjoy your retirement. You do drugs, alcohol, you party, you get ready for high school. You go to grade school, you become a kid, you play, you have no responsibilities, you become a little baby, you go back into the womb, you spend your last nine months floating…

    …and you finish off as an orgasm.”

    –George Carlin

  14. October 21, 2007 12:24 pm

    Melanie, cease spamming my blog thankyou.

  15. October 22, 2007 5:31 pm

    Argghhh… Too many links AV. Askimet ate your comment.

  16. October 22, 2007 7:54 pm

    Apologies.

  17. November 17, 2007 5:08 am

    I often think that creationists not only lack a facility for logical thinking, but that they also lack any moral urge to honesty. Much of the time they are merely parroting misinformation that they are too uneducated to assess, but some of the time they are deliberately, consciously conniving and lying. They appear to have no innate sense that their lies are necessary only because their position is unfounded and illogical.

    Um, by the way, it’s “bear” with me, though “bare with me” or “grin and bare it” do sound like more fun!

  18. November 17, 2007 8:41 am

    Thanks for catching that salient. For some reason I can remember writing “bare” by accident, although I honestly though that I had corrected it!

  19. November 17, 2007 8:49 am

    Oh and agree on the honesty. It’s not just incompetence at critical thinking, it often a lack of an attempt at critical thinking and indeed avoidance of it. I can remember once, a creationist poisoning the well and doing everything they could to deny evidence that Hillsong Church had done something questionable. They even did “extensive research” into the sources, claiming that they were made up sources. The research wasn’t “extensive”; for one of the sources, it was the only thing that turned up in a Google search.

  20. rafael permalink
    December 31, 2007 6:51 am

    THE ATHEIST MENTAL DISORDER

    http://scientistcanotcalculateearth.blogspot.com/

    We will look at the theories of evolution in their two main foundations: the expansion of the universe, and the quantum or microorganism. To understand it with reason, thee first subject we are confronted with is God. Let us read a few verses from the Bible…

    Editor’s note:Blah-de-blah, blah… Yadda, yadda, etc, ad nauseum ad infinitum… Be grateful that I’ve spared you the remaining 12,132 words that formed this cut-and-paste, non-response to my little article. If you actually want to read it, you can go to the above URL. Oh. This guy “Rafael” (ahem) is banned for spamming as well*.

    * Yes, the message of Godtm (as some of his followers interpret it anyway) can constitute spam.

  21. Andrew Lamb permalink
    April 17, 2008 12:50 pm

    I produced a graphical timeline of the interview. You can see it at http://creationontheweb.com/content/view/5712#timeline

  22. April 18, 2008 11:22 am

    Andrew, consider this CMI’s right of reply expressed (further discussion should constitute honest point-by-point analysis).

  23. theism permalink
    April 23, 2008 4:27 pm

    Thanks for posting this; I was mildly concerned when I saw the video.

  24. Melanie Stephan permalink
    June 15, 2008 10:10 am

    Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is. Then compute the odds of favorable mutations needed in creating a product that is beautiful. The aim is always toward beauty in most living creatures. Then of top of that give them feelings, emotions, logic and the need to find a purpose in life. Seriously how can you possibly believe everything came about by accident. Do the math and you will see that the odds are next to impossible. Then the fact that there is a God might give some of us reason to believe he might have had a hand in creating life. Gods code of creation is 3, 2, 8, 5, 21, 34 close to the fibinoce sequence but not quite. The numbers do not progress oderly because there is life, death, then resurrection, life, and so on. The creation code cycle of life is found everywhere. Plants live, die and then resurrect. Always in that order.
    In cell growth, cells divide, give birth, die, resurrect, and divide again. This cycle is repeated 8 times. Then forms into 3 sections. After that it gets more complicated. God is constantly counting as he creates. How do I know that? He told me. Without the death- resurrection cycle cells would constantly double every birth cycle giving you this order. 1, 2, 4, 8, 16, 32, 64, 128 end result an ugly mass. Then according to the evolution theory, resurrection came about by chance. You are born, die, resurrect, then born again. It constantly repeats.

  25. Melanie Stephan permalink
    June 23, 2008 11:27 pm

    God sent this message in the year 2007. The message is this:
    We each die in succession, then we are born on the same day.
    I received this message in a waking dream from God. He had more to say than this. Melanie

  26. June 26, 2008 12:49 am

    I just unspammed your comments Melanie, so people could see how you are hammering this thread to this day. Don’t expect me to do it again.

  27. June 26, 2008 10:57 am

    That’s what you get for putting “creationist” and “crankery” together in the title of this post: you get inundated with creationist cranks! :)

  28. June 26, 2008 11:05 am

    Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is.

    What they have given thought to is the evidence in favour of evolution, and the fact that the arguments from ignorance (e.g. “I personally cannot conceive of how complexity could have emerged naturally, therefore goddidit”) is a logical fallacy and not a rational argument.

    Then compute the odds of favorable mutations needed in creating a product that is beautiful.

    What are the objective, scientifically-established criteria for beauty?

    The aim is always toward beauty in most living creatures.

    What evidence exists that there is someone or something for whom this is an “aim?”

    Then the fact that there is a God

    What objective evidence do you have that there is a God?

    Plants live, die and then resurrect.

    Plants resurrect?

    God is constantly counting as he creates. How do I know that? He told me.

    How can you demonstrate that to anyone else? Why should anyone else believe that God told you anything?

    Then according to the evolution theory, resurrection came about by chance.

    Where does “the evolution theory” talk about resurrection?

  29. June 26, 2008 11:07 am

    Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is.

    What they have given thought to is the evidence in favour of evolution, and the fact that the arguments from ignorance (e.g. “I personally cannot conceive of how complexity could have emerged naturally, therefore goddidit”) is a logical fallacy and not a rational argument.

    Then compute the odds of favorable mutations needed in creating a product that is beautiful.

    What are the objective, scientifically-established criteria for beauty?

    The aim is always toward beauty in most living creatures.

    What evidence exists that there is someone or something for whom this is an “aim?”

    Then the fact that there is a God

    What objective evidence do you have that there is a God?

    Plants live, die and then resurrect.

    Plants resurrect?

    God is constantly counting as he creates. How do I know that? He told me.

    How can you demonstrate that to anyone else? Why should anyone else believe that God told you anything?

    Then according to the evolution theory, resurrection came about by chance.

    Where does “the evolution theory” talk about resurrection?

  30. John Morales permalink
    June 26, 2008 11:32 am

    Um, AV – perhaps fisking something like that resembles gilding the lily? It stands on its own.

  31. June 26, 2008 1:04 pm

    …perhaps fisking something like that resembles gilding the lily? It stands on its own.

    All bar one or two points that AV didn’t mention I think.

    Then compute the odds of favorable mutations needed in creating a product that is beautiful.

    This is implying that randomness is the driver of change in evolution, when in fact it is natural selection which isn’t random.

    The beauty thing actually raises another point. It is far more likely that we evolved an ethology that involved the capacity to see beauty, rather than things evolving to present beauty to us (which is subjective after all).

    Can you picture natural selection favouring the emo-lemmings of the animal kingdom?

  32. John Morales permalink
    June 26, 2008 1:25 pm

    Well, to be honest, this stood out to me:

    Gods code of creation is 3, 2, 8, 5, 21, 34 close to the fibinoce sequence but not quite. The numbers do not progress oderly because there is life, death, then resurrection, life, and so on.

    In cell growth, cells divide, give birth, die, resurrect, and divide again. This cycle is repeated 8 times. Then forms into 3 sections. After that it gets more complicated.

    <sniff> – that’s beautiful. It actually requires a Time Cube scale rating to indicate its awesomeness.
    Less than 0.5, I guess, but, still!

  33. John Morales permalink
    June 26, 2008 1:32 pm

    Anyway, last post on this thread from me.

    I’m no expert, but If the poster is genuine, then I suspect some medical problem exists. Just maybe, a neurological checkup might be indicated here.

  34. June 27, 2008 12:41 pm

    Um, AV – perhaps fisking something like that resembles gilding the lily? It stands on its own.

    You’re right, but sometimes I just can’t resist a good fisking.

  35. Melanie permalink
    July 22, 2008 4:13 am

    To John Morales,
    This is your comment:
    “I’m no expert, but If the poster is genuine, then I suspect some medical problem exists. Just maybe, a neurological checkup might be indicated here.
    John, do you think you are being nice here? Now God said that Richard Dawkins goes to Heaven and he is an Athiest, but God likes him, maybe cause he is smart. He also said that Leona Helmsley goes to hell for being mean. Don’t you think your being a little mean here. Here do mean people go, John, after they die? I am smiling. You never know I could be sitting at the judges table. Smile :-)

  36. Melanie permalink
    July 22, 2008 4:22 am

    God also had something to say about Jerry Falwell, well know TV evangelist. Jerry falls into a third catagory of people that God does not want in Heaven and he does not want to torture him in Hell either. Jerry just disappears, vanishes. What this means is that just believing in Jesus does not quarantee you eternal life in Heaven.

  37. Melanie permalink
    July 22, 2008 4:28 am

    Richard Dawkins goes to Heaven. Leon Helmsley goes to Hell and Jerry Falwell vanishes. I find that assuming. The Atheist gains life in Heaven and the bible toting preacher dies.:-)

  38. Melanie permalink
    July 22, 2008 4:30 am

    I mean, I find that amusing.

  39. Melanie permalink
    July 22, 2008 4:34 am

    I think what I wrote is a work of genius. Sorry for boasting and braggging. A true messager of God should be humble. I do accept advice from those that are wise (wize). I didn’t find any wisdom in what John wrote. Sorry John

  40. John Morales permalink
    July 22, 2008 6:54 am

    Melanie, why do you troll?

  41. July 22, 2008 10:28 am

    Hmmm… She’s been hammering this particularly post continuously since September of last year, most of the posts winding up being caught by Akismet or my filters. Obviously she’s found a way around said filters so I’ll have to update them and think of something new (like contacting her ISP’s abuse line if it gets too much).

    Question is, is this automated or just obsessiveness?

  42. John Morales permalink
    July 22, 2008 7:26 pm

    Oh, I’d say Melanie is a person of indeterminate sex, likely a pseudonym.

    Some sort of specimen, but taxonomy of trolls is not my specialty.

    <shrug>

  43. Hunchback Jack permalink
    August 22, 2008 8:32 am

    Regardless of who Melanie is, she is, sadly, not saying anything new when raising objections to evolution.

    The usual “proof by lack of imagination” arguments, and the usual misstatements about the probability of the complexity of life evolving from a single cell. Easily refuted – even by me, and I’ve only been reading popular science books on this topic for about a year.

    The “beauty” aspect is interesting; I like to think that we see beauty in nature because there’s some survival advantage in being attracted to healthy or safe environments. Nothing I can prove, though.

    HBJ

  44. August 22, 2008 8:43 am

    The “beauty” aspect is interesting; I like to think that we see beauty in nature because there’s some survival advantage in being attracted to healthy or safe environments. Nothing I can prove, though.

    I’ve been thinking the same thing for a while now and I think it’s a neglected argument. There is no Emosaurus Rex in the fossil record.

  45. Hunchback Jack permalink
    August 23, 2008 4:43 am

    Indeed.

    I don’t think it’s that much of a stretch, either. One possible reason that people enjoy looking at views from high places, for example, is that you can see predators or prey at a distance – particularly important for us as we are very sight-dependent animals. So you can blame evolution for the higher cost of houses on hillsides :) .

    Our perception of beauty in nature could be related.

    Not that I think this devalues beauty in any way. It’s unclear to me how you could devalue beauty, in fact.

    HBJ

  46. rafael permalink
    September 4, 2008 9:25 pm

    PROSECUTION
    Is there a God? I will not try to say yes or no to this question. Rather, I will make this place a law court. I will ask you to be the judge, and I will be the prosecutor. The work of a judge is to make decisions, to approve or disapprove the truth of statements; the work of a prosecutor is to present all the evidence and arguments that he can possibly gather. Before we proceed, we have to be clear about one fact: all prosecutors are not eyewitnesses of crimes. They are not policemen. A policeman may personally witness an event, whereas a prosecutor obtains his information only indirectly. He places all the charges, evidence, and arguments collected before the judge. In the same way, I shall present before you everything that I can possibly find. If you ask whether I have seen God or not, I would say “no.” I am reading or demonstrating what I have gathered. My job is to search for facts and to call for witnesses. You are to arrive at a conclusion yourself.
    THE UNIVERSE
    First, looks at nature, the world that is before our eyes and every phenomenon in it. We all know that scientific knowledge is the rational explanation of natural phenomena. For example, there is an observed drop in the temperature of a patient. The drop in temperature is a phenomenon, and the explanation for it is scientific knowledge. When an apple falls from the tree, it is a phenomenon. Why does an apple not fly into the air? The explanation for this phenomenon constitutes knowledge. A man with knowledge is a man who has the proper explanations.
    ONLY TWO EXPLANATIONS
    The universe displays countless phenomena of diverse forms, colors, shapes, and nature. We cannot fail to notice these phenomena before our eyes. The explanation for all these phenomena is known as knowledge. All thoughtful persons have only two explanations as far as the origin of the universe is concerned; there is no third explanation. You have to take one or the other of them. What are these two explanations? The first says that the universe came into being through natural evolution and self-interaction; the second attributes its origin to a personified being with intellect and purpose. These are the only two explanations presented by all philosophers of the world. There is not a third one. Where did the universe come from? Did it come into existence by itself or through chance? Or was it designed by the One from whom we derive the concept of God?
    CHANCE EVENTS
    What are the characteristics of things that come about by chance? First, we know that they are unorganized. At the most they can be partially integrated. They can never be totally organized. One can achieve a specified goal by chance once, but he can never achieve a specified goal by chance all the time. Anything that comes together by chance can only be integrated partially, never totally. For example, if I throw this chair to the other side of the room, by chance it may come to rest at a perfect angle. If I do the same with a second chair, it may also lie neatly beside the first one. But this will not keep on happening with the third and the fourth and so on. Chance can only provide partial organization. It does not guarantee total integration. Furthermore, all random interactions are aimless, disorganized, and purposeless. They are without order and structure; they are loose, formless, disorderly, and not directed toward any meaningful purpose. Briefly, we can say that the characteristics of chance events are disharmony, irregularity, inconsistency, purposelessness, and insignificance.
    CONSISTENCY AND ORGANIZATION
    Now let us compare the things in the universe with these characteristics. Take, for example, the human being. He is carried in his mother’s womb for nine months and delivered; he grows up and eventually dies. This cycle is repeated for every single individual. Consistency can be observed. It is not a wild game of chance. Again, look at the sun above your head. It does not exist purposelessly. Rather, it has its purpose and significance. Look at the moon, the stars, and the myriads of galaxies through your telescope. Some stars have their own planets. They all follow definite tracks and patterns. They are all organized. Their manner of motion can be calculated and predicted. The calendar in your hand is derived from them. Even next year’s calendar can be printed before this year is past. All these show that the universe is organized, consistent, and purposeful.
    MICROORGANISMS
    Let us turn to the micro-world or quantum mechanics. Take a thin slice of wood. Put it under a microscope and observe its grain and structure, all meticulously regular and rhythmic. Even a blade of grass and the petal of a flower are finely fashioned. Nothing is unorganized or confused. Everything is disciplined and functional. All these things witness one fact to you: the universe, with its macro (the whole universe and galaxies) and micro aspects (quantum), is purposeful and meaningful. Can you say that all these came into existence by chance? Surely you cannot.
    CHANCE OR DESIGN
    The universe has to be created by someone with profound wisdom, vast knowledge, and intricate design. If you cannot accept the concept of random formation of the universe, you have to admit that it was created by such a God. There cannot be a third explanation. The choice is left to you. You have to decide if the universe came by chance or whether it was created by God.
    A DEMAND AND ITS OBJECT
    One witness may not be enough. I will call in another. This time we will consider man’s heart. Before doing so, we should also observe one fact: wherever there is a desire, there must first be an object for that desire. For example, an orphan who has never seen his father naturally has a desire for a kind of paternal love. I have asked many people who were orphans, and they all have felt this irrepressible yearning. By this we can see that every desire of the heart arises out of an object in the world. As human beings we have a need for social belonging. We need companionship and mutuality. If you put a boy on a deserted island and he grows up alone, he still has the yearning for companions, for beings like himself, even though he has never seen a human being. This yearning or desire is the very proof that somewhere in the world there is something known as “man.” At a certain age, man begins to think about posterity; he starts desiring children and grandchildren. This is not a mere fantasy. This desire stems out of the existence and possibility of offspring. Hence, where there is desire, there is an object for that desire.
    THERE IS GOD IN THE HEART
    Do we have any desires other than social identity and self-propagation? What other cravings do we have? Deep in everyone there is a craving for God. Whether they are highly civilized races, such as those among the Caucasians, or the ancient civilizations, such as the Chinese civilizations, or the African natives and uncultured aborigines, they all have a common craving –God. As long as they are men, they have a yearning for God, no matter what race or nationality. This is a fact. You cannot argue against it. Everyone is seeking after God. Everywhere man is craving for God. This is very clear. By applying the principle that we just mentioned, we can see that since our heart feels the need for a God, there must necessarily be a God in the universe. Since there is a need for God in the heart, there must be the existence of God in the universe. If no God exists, we would never have such a craving in our heart. We all have an appetite for food. In the same way, we all have an appetite for God. It would be impossible to live if there was only an appetite for food but no food. Likewise, it would be impossible to live if there was a capacity for God but no God.
    NEVER THOUGHT ABOUT GOD?
    Once, an atheist rudely rebuked me in a loud voice: “You said that a man has the psychological need for a God. But there is no such thing, and I do not believe in it.” I said, “Well, do you mean to say that you never think about God? In fact, even while you were talking, you were thinking about Him. This indicates that you do have a capacity for God. There is no one who has never thought about God. He may try not to think much about Him. Since this thought is in you, there must be such an object outside of you.
    “THE WORDS AND THE HEART”
    A young man once came to me to argue about God. He was vehemently against the existence of God. He gave me one reason after another for saying that there is no God. As he was enumerating the various reasons why God should not exist, I listened to him quietly without saying a word. Then I said, “Although you insist that there is no God and support yourself with so many arguments, you have lost your case already.” He said, “What do you mean?” I went on to explain: “Your mouth can say as much as you want about there not being a God, but your heart is on my side.” He had to agree with me. Although one can give all sorts of reasons in the head, there is a belief in the heart that no argument can defeat. A stubborn person may give a thousand and one reasons, but you can have the boldness to tell him, “You know better in your heart that there is a God. Why bother to look for evidence outside?”Now what would you say? After looking at nature and the universe, after checking with your inner feeling, it is up to you to decide whether or not there is a God. But you should not be irresponsible; your attitude must be sober because everyone has to meet God soon. One day you will all stand before Him. Everything concerning you will be laid bare. On that day you will know God. But now is the time for you to be prepared. We should all be prepared to meet our God.
    Finally is there is a God. Who is he? Who among the most ancient religions claim to be God’s son?
    As well there must be a written record of God and God’s son. Among all the ancients’ written records is there such a book?

  47. Melane Stephen permalink
    January 13, 2009 9:34 am

    What Rafael wrote plus that fact that God talked to me kind of answers all of your questions, doesn’t it.

    Rafael, that was long but excellently written.

  48. Melane Stephen permalink
    January 13, 2009 9:44 am

    This is one small piece of proof that God talked to me:

    Like I said earlier, the Holy Spirit talked to me, besides his message about First is Last and Last is First, he had something to say about “Who Killed JFK”. Christ tells me that the man who shot JFK is a policeman. He also tells me the name of the shooter, but it is in a jumbled word. The word is “Fritters”. I see the name F. Ritter right off so I think that is the name of the killer. Now God has lots of other messages for me to figure out, so I put “who Killed JFK” on the back burner for over a year. A year or more later , just recently, I have more time to look for F. Ritter. I can’t find a policeman with that name who lived in Dallas, Texas in 1963. So I am searching for information about who killed JFK and there is a picture of a policeman by the name of J D Tippit. Now Tippit kind of looks like Ritter. Now I unjumble the letters of Ritter to get TIRRET. Now TIRRET looks more like TIPPIT. Now I make the R’s stand at attention, I get TIPPET. One problem is that the I and the E are not the same. So I do some research on the family name TIPPIT. Turns out that in the late 1800’s JD Tippit’s grandfather changed their name from Tippett to Tippit. So the next step I change the E to I. So Tippet is now Tippit.
    Now I have FS Tippit and JD Tippit. The first two initials are not the same. Next I go to Wikipedia there I find; “Some thought that J D stood for “Jefferson Davis” however JD does not stand for anything”. That means his name is just J D. So the initials F S , do not stand for anything. I just have two initials that do not stand for anything. Are you following me?

    Next what does “FRITTERS” mean. If your following my thinking here, God is going to tell you what happened to JD Tippit after he was shot. Fritters are a dough that is deep fried. Bread also means body, like in the last super Christ takes the bread and says this is my body. Look in the dictionary, PIT means HELL. TIP means money paid, gratuity. There are other meanings to. These meanings tell a story.

    JD Tippits body (dough) is placed in the deep fryer (lake of fire). Now I think this clue (Fritters) was ingenius. After all God came up with it. I think he does have a sense of humor too. Kids now have a new game to play. They can play God. Pillsbury dough boy fry’s in the lake of fire. You get HELL! fry baby fry!

    If you think this is just crazy. Remember I am just the messenger. Jesus is the one that had to talk about JFK. So he had a reason for doing that. Only God knows who the killer is. This is proof that Christ talked to me and that is the reason he told me “Who killed JFK”. It is proof. I had forgotten about the case years ago. This is a cold case now, it been 45 years since the shooting.

    I also read the part about giving false prophesy. God says false prophets go to Hell or something like that. I only repeat what God told me. Now what I wrote above is from God. He told me who killed JFK in 2006. The above is not a lie or a joke and I am going to HEAVEN without fear.

    Before I forget. Gods messeges usually have more than one meaning. F S could also stand for “Fence Shooter”.

    Who are the co-conspirators? Turns out that there are two policemen named Tippit, and one Tippett working in the Dallas police Department that same year(1963). Back to the clue word Fritters. That is plural, you know about plural. We have two fritters. The co-conspirators name is Gayle M. Tippit.

    Now the Dallas Police Department obviously covered up and framed Oswald. He was the Patsy. They did it cause it is very possible that one of the other police officers rushing to the scene saw Tippet fleeing the scene carrying a rifle. They covered it up because of the embarrassment of one of their own was the man that killed JFK? And the Warren commission must have also figured that out so they stuck with the Dallas Dept. story saying that it was Oswald. It could have been a National embarrassment. Now if you look at the evidence like I did. It is easy to see that the DAllas Police Dept tampered with the evidence over and over again. And they did a very bad job of it too.

    Now this is my opinion, not Gods. I think God is behind the creation of the Internet. I could never have been able to figure out a lot of his messages without the use of the Internet. People on the Net have been a big help to me. God talks to other people too, they just don’t know it. God let me know it was him.

    Now I just made solving the case of “Who shot JFK?”, look easy. I also gave you proof here. Did you see it? You ask where’s the proof. The proof is that it is impossible for anyone to repeat what I just did above. I mean try it. And I do that over and over again in all of God’s messages.
    See if you can make up a word that is a fried food (like fritters). Unjumble the letters to reveal the name of the killer (Tippit). Then divide the word Tippit into words that describe what happened. Tip- means that JD Tippit was paid for the job and the presidency was over turned. Pit – means that he went to Hell for what he did. Pit means the worst Hell.

    See if you can prove me wrong. Show me how easy it is to make up a name like “Fritters” that solves the crime. This clue is ingenious. God came up with the name “FRITTERS”. God is a genius, not me. I am only the messenger.

    Then the two remaining letters F. S. stands for Fence Shooter. It’s INGENIUS!

    Then on top of that it just so happens that there are two Tippit’s working in the Dallas Police Department in 1963. Fritters (plural) means we have more than one Fritter going in the deep fryer . The other shooter is Gayle M. Tippit. He goes to Hell too. Now I did some research on Gayle M Tippit. There is very little information on him unlike JD Tippit. In my search I found two Gayle Tippit’s still in Dallas. One died in 1967 and the other is married and still lives in Texas. So the other conspirator could still be alive and has managed to avoid detection.

    This is where it gets intesting. Does Gayle M. Tippit come forward and ask God to forgive him? I think he also has to ask the American people to forgive him for his part in the murder of the president or he gets the worst Hell just like JD did. God told me that waiting until the 11th hour is too late. God is forgiving, but you can’t wait until your on your death bed to ask to be forgiven.

    Now if Gayle M. Tippit wants to save himself from the deep fryer. (This could be a long fry, not a quick dip.) He has to come forward and ask to be forgiven. He still gets death or Hell but it won’t be the worst Hell. Just like the worst death is being crucified.

    Gods Messenger, Melanie

    Note: The fact is that it is impossible for you or anyone to come up with a clue like “Fritters”. And I can do that over and over again. You can’t come up with anything that is as ingenius as “Fritters”. Fritters are donuts you know. I always see a cop at the Dunkins Donuts. They make donuts from bad cops you know. Bad cops go in and they don’t come out. I think that is funny. Donuts are really deep fried cops. Next time you have a donut you can think about it. Your really eating a cop.

  49. January 13, 2009 1:37 pm

    Ummm… Sure.

  50. Hoffy permalink
    January 18, 2009 4:29 pm

    Its funny at the very start of this commentary I came across a precious commentory from Malane Stephen and I thought WOW what a complete whack job she must be and then presto I get to this point and see her latest comments and now I see that she is actually STARK RAVING mad, anyone who can write such mumbe jumbo space cadet tripe should be sedated for their own and our safety, cuckoo cuckoo cuckoo

  51. Hoffy permalink
    January 19, 2009 4:17 pm

    Hy Mln , Cck cck cck.

    Moderator’s note: Disemvoweled for trolling. Or counter-trolling. Or whatever. Please don’t bait the trolls, especially the trolls that (at least in theory) can’t respond due to a ban.

  52. hoffy88 permalink
    January 22, 2009 6:42 pm

    oops

  53. Melaine permalink
    May 14, 2009 8:09 am

    I saw the Pope on the news tonight. Now God did not pick the Pope. God picked me over the Pope. I found that interesting. Now I like the Pope very much. I now realize why God picked me over the Pope…

    As always, Melanie

    Moderator’s Note: Post snipped for insanity and threats of hellfire and brimstone.

  54. David permalink
    April 20, 2011 5:14 pm

    Hey Bruce,
    I think I have an answer to your adamic question! The Y chromosone! It is so near identical in all men that many scientists, creationist or otherwise, believe we must have all descended from either one or at most 3 men (Noah’s 3 sons populated the earth after the Flood)!

    So you’ll have to think of another reason for not believing in God now! Judgement Day is coming, my friend!

  55. Blah permalink
    April 26, 2011 7:12 pm

    haha i typed in richard dawkins stumped into google and came across this old thread. anyways, i love how rafael put it – every man has a capacity for God. If you want “proof” of that, well, how about you literally ask every single person if he/she has given a thought about God at least once. Evolutionists can have all this evidence blah blah blah good for them. Sure, evolution occurs to some extent. Heck, it’s even proven I guess. But such evidence doesn’t even deny the existence of a Creator. In fact, evolution may even SUPPORT the existence of a Creator who was “smart” enough to create microorganisms/creatures/matter/whatever that are able to ORDERLY ADAPT to changing environnments for survival. And yes, such adaptation IS technically orderly because a disorderly adaptation would mean that a whole species wouldn’t exist if their changes occurred by chance. If all species adapted by chance (which is basically what evolution is based on), that is IMPROBABLE because chance adaptations would not guarantee or give an orderly record or window of evidence (for evolutionists) of evolved species and continuously evolving species. Think about that ;) Yes, think about what I just said…………………………….

    Do you know why the MAJORITY of this world can care less about evolution? It’s because evolutionists provide such evidence which basically is interpreted to the common man as “we’re all accidents and we’re all doomed and we’re all insignificant and there is no such thing as a God.” Wow, it’s no reason no one cares about your evidence because of your condescending tone, even if it’s true. Such condescension can evoke carelessness and hilarity. Why? Because that evolutionist who thinks he’s so high and mighty just because he’s more “educated and sane” compared to religious or uneducated people is pointless. Ahem…being cocky is literally sad and useless since he’s going to rot in the ground with no soul and no purpose just like every other creationist/theist he intended to offend and refute. So such a feeling of superiority is hilarious because he himself doesn’t have a definitive feeling that there is no God. And that feeling will no never ever go away from him, no matter how much evidence he obtains. That’s fact (and this goes for every single human in existence who doubts the existence of a Creator).

    Well anywaysss, i’m out. i don’t know why i wasted my time on this thread. And please, any one who reads this, don’t reply back to me because I don’ t care what you have to say. And if you do reply to me, it’s only because you literally have nothing else better to do but to try and stir some response out of me again. Such people and their affinity for controversy, get over yourselves ;)

Trackbacks

  1. Creation Science at its best | hell's handmaiden
  2. Owwww… The Spam! It Hurts! « The Thinkers’ Podium
  3. It seemed like a good idea at the time « The Thinkers’ Podium
  4. Reflections on a few points about my resignation… « The Thinkers’ Podium
  5. Film Review: Religulous « Thinkers’ Podium
  6. Example of ugly Christian intolerance. - Page 9

Comments are closed.

Follow

Get every new post delivered to your Inbox.