Creationist crankery flashback: Richard Dawkins stumped?
Recently, I saw a clip on YouTube that uncharacteristically, twinged a feeling of de ja vu but not an actual recollection (uncharacteristic for me; I can usually recall something if I have a memory of it). It was an interview with Richard Dawkins.
Suffice to say, I couldn’t recall the background so I was left to form opinions based on what knowledge I had at hand at the time. I was going to blog about it and point out some mistakes in the implicit message as well as in the triumphalism of the creationist response.
I’ve recently come across accounts of what happened (the missing background information) so the penny has really dropped (add to that there now seems to be a mass YouTube response pointing out the fraud). However, I’ll post the video, then my previous thoughts, before dumping the background story on you.
Response to creationist question
Okay, in answer to the initial creationist question; Flavobacterium Sp. 172 frame-shift mutation allowing the breakdown of nylon. This is the example I’d give to creationists (and have given in the past to the usual response of fingers-in-ears and fallacy) these days, although Dawkins would have had to have used a different mutation as an example given the date of the interview preceding the observation of the mutation of Flavobacterium Sp. 172.
For those who don’t have an understanding of basic genetics (and you’ll need this to get your head around the significance of a frame shift mutation), a strand of nucleic acid is made up of a sequence of four different types of nucleotides. Groups three nucleotides long along the strands of nucleic acid code for a range of amino acids, based on the combination of the four types of nucleotides (4 x 4 x 4 giving a total of 64 possible combinations for each group of three).
A bit abstract so far I know. Please bear with me.
Now, when a group of three nucleotides codes for the amino acid methionine, this is a start codon. It signals the start of a sequence of amino acids.
There are a number of combinations of three nucleotides that form a stop codon and when such combinations are reached during translation it signals the end of a sequence of amino acids. Including the amino acid corresponding to the start codon (methionine), these sequences of amino acids are linked together (by way of a condensation reaction in the ribosome) to form peptides, or in layman’s terms; proteins.
Insulin, histamine, dopamine, adrenalin, growth hormone, IGF-1, blood clotting factors, digestive enzymes and a whole host of other peptides your body needs to function properly are formed at least initially by this process. The sequence of amino acids to make these important hormones/enzymes are translated from your genes.
You can probably work out now what may happen to these enzymes and hormones in people who inherit mutations to the nucleotide sequences coding for them. Tay-Sachs disease is an example, with a range of possible inherited mutations to chromosome 15 damaging the sequence (aka gene) for beta-N-acetylhexosaminidase A; an enzyme that prevents build-ups of gangliosides in the neurons of the brain.
In any case, put a simply as I can, a frame-shift mutation (such as in the example I and others have used to rebut the creationist question) is one where the sequence of nucleotides is altered by the insertion or deletion of a number of nucleotides not divisible by three. This doesn’t just add or take away genetic information, it alters the way existing genetic material is interpreted.
Take for example a hypothetical strand of RNA (AUGGUCAUACUGCAGUAGUAUAUAAAA*) and the amino acid sequence it codes for;
AUG Methionine (START CODON)
GUC Valine
AUA Isoleucine
CUG Leucine
CAG Glutamine
UAG STOP CODON
UAU Tyrosine**
AUA Isoleucine**
AAA Lysine**
* A, U, G and C represent the 4 types of nucleotide (base pairs) in RNA.
** Nucleotides following a “STOP” without a “AUG” for methionine to start things off again, as can be expected, are not translated.
Translated from top-to bottom, this would give us a peptide 5 amino acids long in the sequence of methionine, valine, isoleucine, leucine and finally glutamine. But look what happens if we add just two nucleotides (”AA”) early in the sequence.
AUG Methionine
AAG Lysine
UCA Serine
UAC Tyrosine
UGC Cysteine
AGU Serine
AGU Serine
AUA Isoleucine
UAA STOP
AA (codes for nothing)
With the addition of just two nucleotides, we now have an 8 amino acid long polypeptide with the sequence of methionine, lysine, serine, tyrosine, cysteine, serine, serine, isoleucine. There was no serine in the original sequence, now the peptide is serine rich.
There was no cysteine in the original, and the addition of a cysteine is significant because cysteine can form di-sulphide bonds; if there was a second cysteine elsewhere in the sequence the two cysteines could have bound together folding the peptide into a loop.
In short, a frame-shift mutation can radically alter a peptide/protein, altering the amino acids in the sequence and if displacing stop codons, possibly resulting in a much larger and complex peptide. This is what happened in Flavobacterium Sp. 172; the resultant peptide being “nylonase”, an enzyme that can break down nylon.
Now if we want to talk “information” with the creationists, have a look at the amount of information coding for the two different peptides. Pre and post mutation it’s a ratio of 5:8. And no, the “lost” tyrosine, isoleucine and lysine at the end of the original sequence don’t count as “information”; they weren’t translated in the first place.
Not all mutations are deleterious like those causing Tay-Sachs and some mutations can lead to an “increase in information”. It’s called evolution folks.
Richard Dawkins’ Response
Richard Dawkins talks about intermediates, and the common fallacy that we are descended from modern animals. From what I gathered when I first watched the clip, I gathered Richard Dawkins was trying to ascertain the premise behind the question he was asked.
Indeed, his question does address the modus operandi of the creationists who ask these kinds of “God of the gaps” questions. The creationist finds an area where a scientific theory has not been fully researched, points to the gap in knowledge and claims victory by default (the victory being short lived once the gap is filled in with the results of research; see where “irreducible complexity” meets the sea sponge.)
If the intermediates that Dawkins talks about were alive today alongside their modern counterparts, we could easily undertake genetic research into their differences and the “increases in information”. However, the reality that they aren’t around makes research in evolutionary biology difficult and inevitably means that there will be gaps in our knowledge of the genetic history of life on Earth.
Indeed, if we are to turn the creationists’ absurdity back on themselves so that we could “win by default” and take advantage of practical obstacles to research, we could ask all sorts of silly questions. “Creationist, are you aware of any genetic testing directly confirming the paternal status of Adam to any modern member of the human race?”
The “no example of an increase in information” meme is just another in the series of “God of the gaps” canards doing the rounds by means of the uncritical parroting of a faithful but unthinking and opportunistic movement. Dawkins’ response, while awkward, is actually on topic, although you may be forgiven for thinking otherwise.
The missing details
And this is Dawkins’ account of what happened behind the scenes.
“In September 1997, I allowed an Australian film crew [from the then Answers in Genesis] into my house in Oxford without realising that their purpose was creationist propaganda. In the course of a suspiciously amateurish interview, they issued a truculent challenge to me to “give an example of a genetic mutation or an evolutionary process which can be seen to increase the information in the genome.” It is the kind of question only a creationist would ask in that way, and it was at this point I tumbled to the fact that I had been duped into granting an interview to creationists - a thing I normally don’t do, for good reasons. In my anger I refused to discuss the question further, and told them to stop the camera. However, I eventually withdrew my peremptory termination of the interview as a whole. This was solely because they pleaded with me that they had come all the way from Australia specifically in order to interview me. Even if this was a considerable exaggeration, it seemed, on reflection, ungenerous to tear up the legal release form and throw them out. I therefore relented.
My generosity was rewarded in a fashion that anyone familiar with fundamentalist tactics might have predicted. When I eventually saw the film a year later 1, I found that it had been edited to give the false impression that I was incapable of answering the question about information content 2. In fairness, this may not have been quite as intentionally deceitful as it sounds. You have to understand that these people really believe that their question cannot be answered! Pathetic as it sounds, their entire journey from Australia seems to have been a quest to film an evolutionist failing to answer it.”
(Richard Dawkins, 199
Grrrr…. Barry Williams wrote about the alleged scam in a 1998 edition of The Skeptic. His analysis can be found here.
Well I’m off to bed now. Nite, nite.
~ Bruce
Filed under: Answers in Genesis, Creationism, Culture Wars, Evolution, Honesty, Intelligent Design, Propaganda, Pseudo-science, Religion, Richard Dawkins, Science, Skepticism, Youtube







Definitely not the only time the creationists have resorted to lies and deception: remember that Way of the Master episode, “The Evolution Zone,” where Ray Comfort and Kirk Cameron, in addition to completely misrepresenting evolution, proceed to “prove it wrong” by asking laypeople in the street asinine questions like: “So . . . here is this animal that comes out of the water without lungs, and so he comes out with gills and then goes Puff! Puff! Puff! and then runs back in the water and then keeps coming out until lungs develop? Wow! . . . Was he male or female?” The dishonesty is justified, in their view, because they haven’t the slightest interest in doing science for its own sake: science–or rather, the veneer of science, scienciness–is just another vehicle for proselytising and evangelising. You know all this already, but it certainly bears repeating.
I believe this interview was part of an Answers in Genesis video called “from a frog to a prince” a kids video which shows that they are perfectly fine lying to children.
Yep. I knew that… Although I don’t know why I didn’t mention it. Thanks for that Globalflood.
Hi, Bruce. I enjoyed reading what you wrote about basic genetics. You should read Richards lastest book titled, “I am so much smarter than God”. At the very beginning of the book he states God never finished High School and that he holds a number of BS degrees from various Universities. In the next chapter he then explains
in scientific terms everything in the Universe and how it works. He then continues to name each and every species and how they are a benefit to the ecosystem. In Chapter 3 there are pictures of Richard in the Lab actually creating new life. Turning the page I see a picture of Dawkins and Darwin receiving an award for their work in science. Funny how the name Dawkins and Darwin are almost the same. Then in the last chapter, he goes on to say “See even I can create life, it’s not that hard”.
All I have to say is: Richard do you really expect us to believe that you can create life out of nothing? Don’t you think that people are going to say your nuts? If your going to state that your a scientist I’d think you should have some proof to back up your statements?
Richard do you really expect us to believe that you can create life out of nothing?
He never claimed he could.
Melanie, I’m curious. Why do religious Dawkins haters engage in such dishonesty when apparently it’s prohibited by their religion?
Hi Bruce, I don’t hate Dawkins. I was just a little mad at him at the time. I am not religious either. You’ll never find me in Church on Sunday. God just gave me a job to do. Now, I couldn’t say ‘NO’. Someday I might want God to do something for me so I have been posting for him. God wanted me to post the meaning of First is Last and Last is First to everyone. And I have been posting it everywhere. While I was posting I was reading other peoples posts to. Some one said something about Richard Dawkins. So I Googled his name. He is an Atheist! Not only is he an Atheist, he wrote a book about it. I am thinking, Oh my God, I would never do something like that. Yea, I was mad. Here I am working for free and Richard is out making a buck saying God is like a fairy tale. It was all counter productive. I am putting rocks in the dam and he is taking them out. I am putting up signs for God and he is tearing them down. So I decided to make fun of him, just like a presidential campaign. Let’s get dirty. Anyway there is a problem with fighting with pigs. You only get dirty and the pig enjoys it.
Then God has a talk with me. God says that Richard is not going to hell for being an Atheist. God says that he is an embrassment yet he is fond of him. He thinks of him as a pet. He holds affection for him. Judgment day could be hard on him though. Richard does go to Heaven.
Now I am sorry for what I said about Richard. Richard is entitled to his wrong opinion. We all have the right to be wrong now and again without being sent to Hell for it. I am no longer mad at Richard as long as he doesn’t say anything about Jesus. Richard leave Jesus alone. I love Jesus.
Again Bruce, Thank you for allowing me to write on your site. Sorry it took me so long to get back to you. Melanie Stephan
What the …?
That’s right Bruce. I am not a ……& church lady. To get you up to speed here is Gods message. Gods big issue is about the meaning of First is Last and Last is First . The message is this:
In the morning I go to Heaven. In the afternoon I live my life. In the evening I die, death. What does this mean? In other words this means Birth is Last and Last is Birth. To understand this don’t think from point A to point B. Think of this as a continuous circle of life. Birth, Life, Death, Birth. God also said that Judgment will be before Birth in Heaven. AS birth on Earth is painful so will birth in Heaven. It is possible that this message was delivered by one of God’s Angels. Yes, God has recently made contact and he sent a messenger. Spread this message along, just like a chain letter. OH, one more thing of interest. Did you know that Mike Douglas Died on his Birthday? Melanie
Another thing God also talked about the first 8 steps in Cell growth. I think he talked about that just to let people know he knows something about biology. How many fields of science do you think he knows about? All of them.
Melanie: get thee to a shrink.
AV: I am the perfect size. Maybe a shrink could fix your head. Me thinks it’s to big.
Touche.
But the case remains that you are not the first or only person in the world claiming to have received messages from God, and you won’t be the last.
Sadly, it never dawns on any of you that personal testimony does not constitute good evidence for God’s existence, let alone the claim that God has spoken to you (which implies the claim that a God exists). Not even close. If I were to tell you that a spaceship full of green aliens landed in my backyard last night, would you take my word for it? Think about it.
Now, I don’t think you’re lying about what you claim to have experienced. I accept that you believe that God spoke to you–but this does not mean that it actually happened. There are natural explanations (e.g. auditory hallucination), and parsimony demands that you rule out natural explanations absolutely before you posit supernatural ones.
Here’s some chain mail for you:
Critical Thinking on the Web
“A Mini Guide to Critical Thinking” (PDF)
“The Belief Engine” (James Alcock)
Salvation lies within.
That’s right Bruce. I am not a ……& church lady. To get you up to speed here is Gods message. Gods big issue is about the meaning of First is Last and Last is First . The message is this:
In the morning I go to Heaven. In the afternoon I live my life. In the evening I die, death.
“The most unfair thing about life is the way it ends. I mean, life is tough. It takes up a lot of your time. What do you get at the end of it? A Death! What’s that, a bonus? I think the life cycle is all backwards. You should die first, get it out of the way. Then you live in an old age home. You get kicked out when you’re too young, you get a gold watch, you go to work. You work forty years until you’re young enough to enjoy your retirement. You do drugs, alcohol, you party, you get ready for high school. You go to grade school, you become a kid, you play, you have no responsibilities, you become a little baby, you go back into the womb, you spend your last nine months floating…
…and you finish off as an orgasm.”
–George Carlin
Melanie, cease spamming my blog thankyou.
Argghhh… Too many links AV. Askimet ate your comment.
Apologies.
[...] article about a bit of creationist dishonesty over at The Thinkers’ Podium. It is the tale of an edited interview with Dawkins. Its a good [...]
I often think that creationists not only lack a facility for logical thinking, but that they also lack any moral urge to honesty. Much of the time they are merely parroting misinformation that they are too uneducated to assess, but some of the time they are deliberately, consciously conniving and lying. They appear to have no innate sense that their lies are necessary only because their position is unfounded and illogical.
Um, by the way, it’s “bear” with me, though “bare with me” or “grin and bare it” do sound like more fun!
Thanks for catching that salient. For some reason I can remember writing “bare” by accident, although I honestly though that I had corrected it!
Oh and agree on the honesty. It’s not just incompetence at critical thinking, it often a lack of an attempt at critical thinking and indeed avoidance of it. I can remember once, a creationist poisoning the well and doing everything they could to deny evidence that Hillsong Church had done something questionable. They even did “extensive research” into the sources, claiming that they were made up sources. The research wasn’t “extensive”; for one of the sources, it was the only thing that turned up in a Google search.
THE ATHEIST MENTAL DISORDER
http://scientistcanotcalculateearth.blogspot.com/
We will look at the theories of evolution in their two main foundations: the expansion of the universe, and the quantum or microorganism. To understand it with reason, thee first subject we are confronted with is God. Let us read a few verses from the Bible…
Editor’s note: … Blah-de-blah, blah… Yadda, yadda, etc, ad nauseum ad infinitum… Be grateful that I’ve spared you the remaining 12,132 words that formed this cut-and-paste, non-response to my little article. If you actually want to read it, you can go to the above URL. Oh. This guy “Rafael” (ahem) is banned for spamming as well*.
* Yes, the message of Godtm (as some of his followers interpret it anyway) can constitute spam.
I produced a graphical timeline of the interview. You can see it at http://creationontheweb.com/content/view/5712#timeline
Andrew, consider this CMI’s right of reply expressed (further discussion should constitute honest point-by-point analysis).
Thanks for posting this; I was mildly concerned when I saw the video.
Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is. Then compute the odds of favorable mutations needed in creating a product that is beautiful. The aim is always toward beauty in most living creatures. Then of top of that give them feelings, emotions, logic and the need to find a purpose in life. Seriously how can you possibly believe everything came about by accident. Do the math and you will see that the odds are next to impossible. Then the fact that there is a God might give some of us reason to believe he might have had a hand in creating life. Gods code of creation is 3, 2, 8, 5, 21, 34 close to the fibinoce sequence but not quite. The numbers do not progress oderly because there is life, death, then resurrection, life, and so on. The creation code cycle of life is found everywhere. Plants live, die and then resurrect. Always in that order.
In cell growth, cells divide, give birth, die, resurrect, and divide again. This cycle is repeated 8 times. Then forms into 3 sections. After that it gets more complicated. God is constantly counting as he creates. How do I know that? He told me. Without the death- resurrection cycle cells would constantly double every birth cycle giving you this order. 1, 2, 4, 8, 16, 32, 64, 128 end result an ugly mass. Then according to the evolution theory, resurrection came about by chance. You are born, die, resurrect, then born again. It constantly repeats.
God sent this message in the year 2007. The message is this:
We each die in succession, then we are born on the same day.
I received this message in a waking dream from God. He had more to say than this. Melanie
I just unspammed your comments Melanie, so people could see how you are hammering this thread to this day. Don’t expect me to do it again.
That’s what you get for putting “creationist” and “crankery” together in the title of this post: you get inundated with creationist cranks!
Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is.
What they have given thought to is the evidence in favour of evolution, and the fact that the arguments from ignorance (e.g. “I personally cannot conceive of how complexity could have emerged naturally, therefore goddidit”
is a logical fallacy and not a rational argument.
Then compute the odds of favorable mutations needed in creating a product that is beautiful.
What are the objective, scientifically-established criteria for beauty?
The aim is always toward beauty in most living creatures.
What evidence exists that there is someone or something for whom this is an “aim?”
Then the fact that there is a God
What objective evidence do you have that there is a God?
Plants live, die and then resurrect.
Plants resurrect?
God is constantly counting as he creates. How do I know that? He told me.
How can you demonstrate that to anyone else? Why should anyone else believe that God told you anything?
Then according to the evolution theory, resurrection came about by chance.
Where does “the evolution theory” talk about resurrection?
Any one that could possibly believe in evolution really hasn’t given very much thought to how complex life is or how diversified it is.
What they have given thought to is the evidence in favour of evolution, and the fact that the arguments from ignorance (e.g. “I personally cannot conceive of how complexity could have emerged naturally, therefore goddidit”
is a logical fallacy and not a rational argument.
Then compute the odds of favorable mutations needed in creating a product that is beautiful.
What are the objective, scientifically-established criteria for beauty?
The aim is always toward beauty in most living creatures.
What evidence exists that there is someone or something for whom this is an “aim?”
Then the fact that there is a God
What objective evidence do you have that there is a God?
Plants live, die and then resurrect.
Plants resurrect?
God is constantly counting as he creates. How do I know that? He told me.
How can you demonstrate that to anyone else? Why should anyone else believe that God told you anything?
Then according to the evolution theory, resurrection came about by chance.
Where does “the evolution theory” talk about resurrection?
Um, AV - perhaps fisking something like that resembles gilding the lily? It stands on its own.
…perhaps fisking something like that resembles gilding the lily? It stands on its own.
All bar one or two points that AV didn’t mention I think.
Then compute the odds of favorable mutations needed in creating a product that is beautiful.
This is implying that randomness is the driver of change in evolution, when in fact it is natural selection which isn’t random.
The beauty thing actually raises another point. It is far more likely that we evolved an ethology that involved the capacity to see beauty, rather than things evolving to present beauty to us (which is subjective after all).
Can you picture natural selection favouring the emo-lemmings of the animal kingdom?
Well, to be honest, this stood out to me:
Gods code of creation is 3, 2, 8, 5, 21, 34 close to the fibinoce sequence but not quite. The numbers do not progress oderly because there is life, death, then resurrection, life, and so on.
…
In cell growth, cells divide, give birth, die, resurrect, and divide again. This cycle is repeated 8 times. Then forms into 3 sections. After that it gets more complicated.
<sniff> - that’s beautiful. It actually requires a Time Cube scale rating to indicate its awesomeness.
Less than 0.5, I guess, but, still!
Anyway, last post on this thread from me.
I’m no expert, but If the poster is genuine, then I suspect some medical problem exists. Just maybe, a neurological checkup might be indicated here.
Um, AV - perhaps fisking something like that resembles gilding the lily? It stands on its own.
You’re right, but sometimes I just can’t resist a good fisking.
To John Morales,
This is your comment:
“I’m no expert, but If the poster is genuine, then I suspect some medical problem exists. Just maybe, a neurological checkup might be indicated here.
John, do you think you are being nice here? Now God said that Richard Dawkins goes to Heaven and he is an Athiest, but God likes him, maybe cause he is smart. He also said that Leona Helmsley goes to hell for being mean. Don’t you think your being a little mean here. Here do mean people go, John, after they die? I am smiling. You never know I could be sitting at the judges table. Smile
God also had something to say about Jerry Falwell, well know TV evangelist. Jerry falls into a third catagory of people that God does not want in Heaven and he does not want to torture him in Hell either. Jerry just disappears, vanishes. What this means is that just believing in Jesus does not quarantee you eternal life in Heaven.
Richard Dawkins goes to Heaven. Leon Helmsley goes to Hell and Jerry Falwell vanishes. I find that assuming. The Atheist gains life in Heaven and the bible toting preacher dies.
I mean, I find that amusing.
I think what I wrote is a work of genius. Sorry for boasting and braggging. A true messager of God should be humble. I do accept advice from those that are wise (wize). I didn’t find any wisdom in what John wrote. Sorry John
Melanie, why do you troll?
Hmmm… She’s been hammering this particularly post continuously since September of last year, most of the posts winding up being caught by Akismet or my filters. Obviously she’s found a way around said filters so I’ll have to update them and think of something new (like contacting her ISP’s abuse line if it gets too much).
Question is, is this automated or just obsessiveness?
Oh, I’d say Melanie is a person of indeterminate sex, likely a pseudonym.
Some sort of specimen, but taxonomy of trolls is not my specialty.
<shrug>